ABSTRACT
ObjectiveTo established a cell line that expresses hBD1 stably,and detected the antimicrobial activity of the hBD1 to the muhidrug resistant bacterial strains.MethodsRecombinant plasmid was introduced into COS-7 cells by lipofectamine,cells were selected in culture medium containing G418 to acquired the monoclonal cell lines,total RNA were extracted from the cultured cells,expression levels of hBD1 mRNA was identified by RT-PCR,collected the supernatant solution of the cultured cell,expression levels of protein was identified by Western blot.Put the expression products and resistant organisms mixed together,after incubation in different times in 37℃,coating the mixtures in LB flat,then obtained the ratios between colonies number of experimental groups and colonies number of control groups,put those ratios as the survival rate of the drug resistance bacterias.Results The monoclonal cell lines had obtained after screened with G418,the hBD1 gene could be detected both at transcriptional and protein levels,Under the influence of expression product hBD1,survival rate of muhidrug-resistant Acinetobacter baumannii,multidrug-resistant Escherichia coli and multidrug-resistant Klebsiella pneumoniae could reduced to 9%,22% and 50%,but survival rate of multidrug-resistant Stenotrophomonas maltophilia is not have apparente difference with the control group.ConclusionThe stably-transfected cell line of hBD1 was successfully constructed,and the expression products of hBD1 showed the antimicrobial activity toward multidrug resistant bacterial strains.
ABSTRACT
AIM: To investigate the developmental regulation of β-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P1: TTCAGTCATGAGGATCCATT AC; P2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS： Rat β-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION： The rat β-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that β-defensin-2 may play a role in the lung innate defense against infection.
ABSTRACT
AIM: To study the regulation of rat ?-defensin-2 gene expression by bacteria.METHODS: E.coli ML-35 p and pseudomonas aeruginosa were injected into rat trachea. Total RNA was isolated from lung tissue after 24 h inoculation. RT-PCR and Northern blot were performed to detect ?-defensin-2 ( rBD-2 ) mRNA expression.RESULTS: The expression of rBD-2 gene was inhibited in the lung tissue by E.coli infection, but not by pseudomonas aeruginosa. CONCLUSION: These results indicated that E.coli infection could down-regulate rBD-2 gene expression in the rat lung tissues.
ABSTRACT
AIM: To investigate the developmental regulation of ?-defensin rBD-2 gene expression in the rat lung. METHOD: Total RNA was isolated from the pulmonary tissues of the fetal, neonatal and adult rats. RT-PCR were performed with primers (P 1: TTCAGTCATGAGGATCCATT AC; P 2: TGGAACTTGGTCTTTTTATCTAC). The RT-PCR products were cloned into pGEM-T easy vector and the recombinant plasmid was analyzed with EcoR1 digestion and the inserted DNA sequencing was performed on ABI PRISM-377 DNA sequencer. RESULTS: Rat ?-defensin-2 transcripts were detected in all the pulmonary tissues of rats during different developmental stages, e.g. at just before birth, 8 hours and 4 days after birth , and adult. CONCLUSION: The rat ?-defensin-2 is constitutively expressed in the pulmonary tissues, suggesting that ?-defensin-2 may play a role in the lung innate defense against infection.